Free Comparative Oncology:TP53 Gene phylogeographic genomic diversity among Kenyan Elephants (Loxodonta africana ) and its significance in Cancer Tumor Resistance. Dissertation Example

0 / 5. 0

Comparative Oncology:TP53 Gene phylogeographic genomic diversity among Kenyan Elephants (Loxodonta africana ) and its significance in Cancer Tumor Resistance.

Category: Cancer

Subcategory: Dissertation proposal

Level: Masters

Pages: 15

Words: 8250

Query nucleotide sequence
ATGGAGGAGCCCCAGAGCGACCTGAGCACCGAGCTGCCCCTGAGCCAGGAGACCTTCAGC
TACCTGTGGGAGCTGCTGCCCGAGAACCCCGTGCTGCTGCAGAGCCCCACCCTGCCCCCC
GCCGTGGAGGTGATGGACGACCTGCTGCTGAGCGAGGACACCGCCAACTGGCTGGAGAGC
CAGGTGGAGGCCCAGGGCATGAGCACCACCCCCGCCCCCGCCACCCCCACCCCCGTGGCC
CCCGCCCCCGCCACCAGCTGGACCCTGAGCAGCAGCGTGCCCAGCCAGAAGACCTACCCC
GGCACCTACGGCTTCAGGCTGGGCTTCCTGCACAGCGGCACCGCCAAGAGCGTGACCTGC
ACCTACAGCCCCGACCTGAACAAGCTGTTCTGCCAGCTGGCCAAGACCTGCCCCGTGCAG
CTGTGGGTGGCCAGCCCCCCCCCCCCCGGCACCAGGGTGAGGACCATGGCCATCTACAAG
AAGAGCGAGCACATGACCGAGGTGGTGAAGAGGTGCCCCCACCACGAGAGGTGCAGCGAC
AGCAGCGACGGCCTGGCCCCCCCCCAGCACCTGATCAGGGTGGAGGGCAACCTGAGGGCC
GAGTACCTGGAGGACAGCATCACCCTGAGGCACAGCGTGGTGGTGCCCTACGAGCCCCCC
GAGGTGTGGTTCGGCAACGGCGCCCTGTGGGAGAGCTTCATGTGCAACAGCAGCTGCATG
GGCGGCATGAACAGGAGGCCCATCCTGACCATCATCACCCTGGAGGACAGCAGCGGCAAC
CTGCTGGGCAGGAACAGCTTCGAGGTGAGGATCTGCGCCTGCCCCGGCAGGGACAGGAGG
ACCGAGGAGGAGAACTTCCACAAGAAGGGCGAGCCCTGCCCCGAGCCCCCCCCCCCCGGC
AGGAGCACCAAGAGGGCCCTGCCCACCAACACCAGCAGCAGCACCCAGCCCAAGAAGAAG
CCCCTGGACGAGGAGTACTTCACCCTGCAGATCAGGGGCAGGGAGAGGTTCAAGATGTTC
CTGGAGCTGAACGAGGCCCTGGAGCTGAAGGACGCCCAGGCCGGCAAGGAGCCCGAGGGC
AGCAGGGCCCACAGCAGCCCCAGCAAGAGCAAGAAGGGCCAGAGCACCAGCAGGCACAAG
AAGCCCATGTTCAAGAGGGAGGGCCCCGACAGCGAC

All Examples

Do you need an original paper?

Approach our writing company and get top-quality work written from scratch strictly on time!

Get an original paper